What did the bartender say to the angry speaker?

We don't want any treble

Previous Random Joke Next

Want Jokes More Want Jokes

Why didn't Lebron go to college?

He didn't want to show up for the finals

Why don't married men live as long as single men?

They don't want to!

Bartender Jokes More Bartender Jokes

What did the bartender say to the jumper cables?

You better not try to start anything.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.