What did the bartender say to the angry speaker?

We don't want any treble

Previous Random Joke Next

Want Jokes More Want Jokes

Why doesn't San Antonio have a pro football team?

Because then Dallas would want one too.

Why are Aspirins and Paracetamol white?

Well, you want them to work, don't you?

Bartender Jokes More Bartender Jokes

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.