Bartender Jokes

What's the difference between a mixologist and a bartender?

About ten minutes.

Couple's Daily Question Mug

$19.99

How do you pay a bartender?

With bar tender.

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

What did the bartender say to the alien?

You're drunk ET, go home!

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

What do you call a bartender giving two dolphins a drink?

Serving dual porpoises!

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

What did the straight edge ghost say to the bartender?

No boos for me.

What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

How much for a beer?

The bartender replies: "For you No charge."

What'll ya have?

Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.

Everyday Deserves a Joke

$19.99

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

What did the brown dwarf say to the bartender?

I'd like a Corona, please.

Why the sad face?

Asks the bartender. "I got fired."

What did the bartender say to the jumper cables when they walked into the bar?

Ok you 2 dont start anything

How much for a drink?

The bartender replies, "For you No charge."

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What did the bartender say to the jumper cables?

You better not try to start anything.

What did the bartender say to the angry speaker?

We don't want any treble

What did the alcoholic Dad, away on business, say to the bartender at the hotel bar?

I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

I've Got a Whole Latte Jokes

$19.99

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What can I get you?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"

When he finishes drinking, he pulls out his wallet and say to the Bartender, "How much?

The Bartender says, "For you No charge."

How much will that be?

Asks the neutron. "For you " replies the bartender, "no charge."

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!

Where is all the color white?

Bartender says, "dude, this is a gray bar.

A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

A DHCP packet walks into a bar and asks for a beer.

Bartender says, "here, but I’ll need that back in an hour!"

You might also enjoy:

James Bond Jokes More James Bond Jokes

Who is James Bond's favorite bartender?

Michael J Fox

Why is James Bond's favourite bartender played by Michael J Fox?

He doesn't need to tell him to shake the martini.

Idk Jokes More Idk Jokes

How long has he been having convulsions?

IDK HE'S WHITE, I THOUGHT HE WAS DANCING

Why won't people know when you replace words with instruments?

Idk, accordion to research I guess.

Harambe Jokes More Harambe Jokes

What do bullets and I have in common?

We don't miss Harambe.

What can I get you?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.

Confuse Jokes More Confuse Jokes

Why do so many math majors confuse Halloween and Christmas?

Because Oct 31 is Dec 25

How do you confuse Pareto?

Tell him you belong to "the" 20%.

Encourage Jokes More Encourage Jokes

How do hens encourage their football teams?

They egg them on!

Why don't you ever wear your hair down?

Me: It makes me look approachable. CW: So Me: I don't want to encourage that.

Michael J. Fox Jokes More Michael J. Fox Jokes

Why does Michael J. Fox make the best milkshakes?

He uses the finest ingredients.

What do bad dancers have in common with Michael J Fox trying to use the soft serve ice cream machine?

They both have a hard time pulling off a twist.

Wallet Jokes More Wallet Jokes

When he finishes drinking, he pulls out his wallet and say to the Bartender, "How much?

The Bartender says, "For you No charge."

Why is New Jersey called the Garden State?

Cause you're always guardin' your wallet, guardin' your car, and guardin' your house.

Ask Jokes More Ask Jokes

When she approached my car window I asked what's wrong officer?

She said "ugh nothing!"

Why do Vampires make poor project managers?

Because the refuse you to meet with stake holders. (why yes, I am a dad why do you ask)