About ten minutes.
Interactive Joke of the Day Mug
Coffee Mug
With bar tender.
It was worth a shot.
You're drunk ET, go home!
Because there's a BartEnder there.
No have to cut me off. Fall off barstool by myself. end metajoke
Bcoz they are single, have no kids, got nailed and serve alcoholic beverage.
A horse walks into a bar. Bartender: why the long face? Horse: because I'm a raging alcoholic.
Serving dual porpoises!
Long neck or giraffed?
No boos for me.
Couple's Daily Question Mug
Bartender: Why the long face Horse: My alcoholism is destroying my family.
Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.
The bartender says.
The bartender replies: "For you No charge."
Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.
OH SNaP!
I'd like a Corona, please.
Asks the bartender. "I got fired."
Ok you 2 dont start anything
The bartender replies, "For you No charge."
No, I think I'd like some more-ay.
You better not try to start anything.
Asks the bartender. The bear replies "Well, I am a bear"
Asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.
We don't want any treble
You're cut off.
I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either
The bartender replies, "For you, neutron, no charge."
And the bartender says, I don't know, but I've heard he's a shady character!
Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.
You're not a bartender! You're just a pharmacist.
The bartender says, "Central Park."
Just say "I don't know, make something up"
The Bartender says, "For you No charge."
Asks the neutron. "For you " replies the bartender, "no charge."
Xanax since he's a Bartender
AU, get outta here!
That's the spirit!" How do you discourage a bartender Boos.
Bartender says, "dude, this is a gray bar.
I'm sorry, we don't serve food here
Pop,goes the weasel.
Bartender says, "here, but I’ll need that back in an hour!"
Idk, accordion to research I guess.
I keep asking people, but they don't know either.
He's gonna lure him in to the crypt tonight.
None, ducks are not allowed in politics.
I'd rather have a bottle in front of me than a frontal lobotomy.
Shots.
In a moooo-tel. I just thought of this sitting in my hotel room. Sometimes I feel like i dad joke so hard I impregnate my girlfriend from 100 miles away.
I'm gonna give 110%
The South Will Rise Again
An eagle. They're so majestic." MEANWHILE Horse: hey eagle, what's your spirit human Eagle: this guy Dave
They get in an elevator to lift their spirits.
They both have a hard time pulling off a twist.
Shaken. Not stirred
Silver Mullet
A "casual tea"