About ten minutes.
With bar tender.
It was worth a shot.
You're drunk ET, go home!
Because there's a BartEnder there.
No have to cut me off. Fall off barstool by myself. end metajoke
Bcoz they are single, have no kids, got nailed and serve alcoholic beverage.
Serving dual porpoises!
Long neck or giraffed?
No boos for me.
Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.
The bartender says.
The bartender replies: "For you No charge."
Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.
OH SNaP!
I'd like a Corona, please.
Asks the bartender. "I got fired."
Ok you 2 dont start anything
The bartender replies, "For you No charge."
No, I think I'd like some more-ay.
You better not try to start anything.
Asks the bartender. The bear replies "Well, I am a bear"
Asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.
We don't want any treble
You're cut off.
I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either
The bartender replies, "For you, neutron, no charge."
And the bartender says, I don't know, but I've heard he's a shady character!
Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.
You're not a bartender! You're just a pharmacist.
The bartender says, "Central Park."
Just say "I don't know, make something up"
The Bartender says, "For you No charge."
Asks the neutron. "For you " replies the bartender, "no charge."
Xanax since he's a Bartender
AU, get outta here!
That's the spirit!" How do you discourage a bartender Boos.
Bartender says, "dude, this is a gray bar.
I'm sorry, we don't serve food here
Pop,goes the weasel.
Bartender says, "here, but I’ll need that back in an hour!"
She didn't want six inches of snow all year long.
You usually want to stand at a corner, they're around 90 degree's
Bubble-0-7
He doesn't need to tell him to shake the martini.
A Gladiator
Girl: Your feet.
The clerk said "Just a minute..." "Thank you" the man said and hung up.
Both are measured in revolutions per minute.
Skip
Speed is relative, officer.
He drinks it just like he drinks every other kind of spirit.
The landlord said "Sorry we don't serve spirits."
Like, did you ask him Because only one of us is screaming right now.
Isn't predator an alien too They should've just called it "Some Aliens"