About ten minutes.
With bar tender.
It was worth a shot.
You're drunk ET, go home!
Because there's a BartEnder there.
No have to cut me off. Fall off barstool by myself. end metajoke
Bcoz they are single, have no kids, got nailed and serve alcoholic beverage.
Serving dual porpoises!
Long neck or giraffed?
No boos for me.
Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.
The bartender says.
The bartender replies: "For you No charge."
Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.
OH SNaP!
I'd like a Corona, please.
Asks the bartender. "I got fired."
Ok you 2 dont start anything
The bartender replies, "For you No charge."
No, I think I'd like some more-ay.
You better not try to start anything.
Asks the bartender. The bear replies "Well, I am a bear"
Asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.
We don't want any treble
You're cut off.
I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either
The bartender replies, "For you, neutron, no charge."
And the bartender says, I don't know, but I've heard he's a shady character!
Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.
You're not a bartender! You're just a pharmacist.
The bartender says, "Central Park."
Just say "I don't know, make something up"
The Bartender says, "For you No charge."
Asks the neutron. "For you " replies the bartender, "no charge."
Xanax since he's a Bartender
AU, get outta here!
That's the spirit!" How do you discourage a bartender Boos.
Bartender says, "dude, this is a gray bar.
I'm sorry, we don't serve food here
Pop,goes the weasel.
Bartender says, "here, but I’ll need that back in an hour!"
Me: Out. I can't stand being hemmed in by four walls. Wife: How many walls has the pub got Five
A barredvark!
Nothing - either way someone's gonna lose a trailer *shamelessly stolen from Robin Williams
A) I don't know he also stole my watch.
They get chapped lips
Girls: You Should be on TV for your talent. Boy: Am i so good..... Boy: if you were on TV, i can atleast switch it off...
Spirits
He wanted to keep his spirits high.
What did the elephant say when it was pulled out of a pit by the Balls? Thank you Mr. And Mrs. Ball!
Have you ever tried pulling apart a grilled cheese?!
Bartender: Why the long face Horse: My alcoholism is destroying my family.
I'd rather have a bottle in front of me than a frontal lobotomy.
It doesn't matter. He has to ask his wife first.
I'm asking for for a friend.
China probably can pop corn in one minute.
Both are measured in revolutions per minute.
