Bartender Jokes

What's the difference between a mixologist and a bartender?

About ten minutes.

Everyday Deserves a Joke

$19.99

How do you pay a bartender?

With bar tender.

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

What did the bartender say to the alien?

You're drunk ET, go home!

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

What do you call a bartender giving two dolphins a drink?

Serving dual porpoises!

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

What did the straight edge ghost say to the bartender?

No boos for me.

What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

What did the brown dwarf say to the bartender?

I'd like a Corona, please.

I've Got a Whole Latte Jokes

$19.99

What did the bartender say to the jumper cables when they walked into the bar?

Ok you 2 dont start anything

How much for a drink?

The bartender replies, "For you No charge."

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What did the bartender say to the jumper cables?

You better not try to start anything.

What did the bartender say to the angry speaker?

We don't want any treble

What did the alcoholic Dad, away on business, say to the bartender at the hotel bar?

I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What can I get you?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.

Couple's Daily Question Mug

$19.99

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

How much will that be?

Asks the neutron. "For you " replies the bartender, "no charge."

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!

A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

A DHCP packet walks into a bar and asks for a beer.

Bartender says, "here, but I’ll need that back in an hour!"

You might also enjoy:

Difference Jokes More Difference Jokes

What's the difference between a meeting and a funeral?

A funeral is a meeting where you're dead outside as well as in.

What is the difference between deer nuts and beer nuts?

Deer nuts are under a buck.

Destroy Jokes More Destroy Jokes

Which duck will destroy the establishment?

None, ducks are not allowed in politics.

Why did you destroy that urinal cake?

Peer pressure

Xanax Jokes More Xanax Jokes

Alcoholism Jokes More Alcoholism Jokes

How do you prevent alcoholism?

Shots.

What's the difference between alcoholism and a lobotomy?

I'd rather have a bottle in front of me than a frontal lobotomy.

James Bond Jokes More James Bond Jokes

What does James Bond say after a heavy workout?

I would like to have Whey. Shaken, not stirred.

How does James Bond type e-mails?

With his goldfinger.

Finish Jokes More Finish Jokes

How much equations does it take to finish a math test?

Only Sum

Why was the blond excited when she finished her puzzle after 6 months?

Because the box said 2-4 years!

Minute Jokes More Minute Jokes

What did the pool cleaner say to the impatient swimmer?

Whoa, whoa, whoa... Wade just a minute.

How do you get a dozen eggs out of a washing machine in less than a minute?

I'm serious... help.

Pull Jokes More Pull Jokes

Why is a fire truck always red?

Cause you'd be mad too if someone kept pulling your hose.

What do Bristol Palin and Iraq have in common?

It's just so hard to pull out.