Bartender Jokes

What's the difference between a mixologist and a bartender?

About ten minutes.

Everyday Deserves a Joke

Everyday Deserves a Joke

$19.99

How do you pay a bartender?

With bar tender.

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

What did the bartender say to the alien?

You're drunk ET, go home!

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

What did the drunk Chinese customer say to the bartender?

No have to cut me off. Fall off barstool by myself. end metajoke

What do you call a bartender giving two dolphins a drink?

Serving dual porpoises!

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

What did the straight edge ghost say to the bartender?

No boos for me.

What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

How much for a beer?

The bartender replies: "For you No charge."

I've Got a Whole Latte Jokes

I've Got a Whole Latte Jokes

$19.99

What'll ya have?

Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

What did the brown dwarf say to the bartender?

I'd like a Corona, please.

Why the sad face?

Asks the bartender. "I got fired."

What did the bartender say to the jumper cables when they walked into the bar?

Ok you 2 dont start anything

How much for a drink?

The bartender replies, "For you No charge."

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What did the bartender say to the jumper cables?

You better not try to start anything.

Why the long pause?

Asks the bartender. The bear replies "Well, I am a bear"

What did the bartender say to the angry speaker?

We don't want any treble

Couple's Daily Question Mug

Couple's Daily Question Mug

$19.99

What did the bartender say to the foreskin?

You're cut off.

What did the alcoholic Dad, away on business, say to the bartender at the hotel bar?

I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What can I get you?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"

When he finishes drinking, he pulls out his wallet and say to the Bartender, "How much?

The Bartender says, "For you No charge."

How much will that be?

Asks the neutron. "For you " replies the bartender, "no charge."

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!

Where is all the color white?

Bartender says, "dude, this is a gray bar.

A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

A DHCP packet walks into a bar and asks for a beer.

Bartender says, "here, but I’ll need that back in an hour!"

You might also enjoy:

Need Jokes More Need Jokes

How many blondes does it take to change a lightbulb?

Need to know ASAP.

Why do we need to go to college?

Student: Why do we need to go to college? Teacher: So we can get a high paying job Student: Why do we need a high paying job Teacher: So we can get lots of money Student: Why do we need lots of money Teacher: So we can pay off our college loans

Spirit Jokes More Spirit Jokes

What's your spirit animal?

An eagle. They're so majestic." MEANWHILE Horse: hey eagle, what's your spirit human Eagle: this guy Dave

Why did the ghost go into the elevator?

To lift his spirits.

Pay Jokes More Pay Jokes

Why do they thank me in the cafeteria when I pay for my food like I had a choice?

Just tell me "enjoy the diarrhea" and I'll move along.

Why do Canadians not pay attention to their local wildlife?

Because there's nothing to care-aboot. (caribou)

Consume Jokes More Consume Jokes

Why do whales have really good immune systems?

They consume a lot of vitamin SEA!

How many fish did it take to consume my wife?

None. There are no fish under my new gazebo

Neutron Jokes More Neutron Jokes

How much will that be?

Asks the neutron. "For you " replies the bartender, "no charge."

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

Steal Jokes More Steal Jokes

What kind of jeans does Mario wear?

Denim denim denim.(http://youtu.be/rdnTvgK2o5I) shamelessly stolen from tumblr

Why did the spy steal the laptop?

It had a sticker that said 'intel inside'.

Xanax Jokes More Xanax Jokes

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender

Why did the Mexican take Xanax?

For Hispanic attacks.

Girl Jokes More Girl Jokes

What's the difference between a boy and a girl?

His dad answers, "Well, there's a vas deferens!"

Why doesn't Kirk like to have one-night stands?

Because the girls always cling on him afterwards.