A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

Previous Random Joke Next

Walk Jokes More Walk Jokes

What walks on 8 legs until it's one years old, 4 legs until it's twenty years old and then 2 legs for the remainder of it's life?

Fred and George Weasley.

Why do cows never walk out of horror movies?

They're able to stomach a lot.

Serve Jokes More Serve Jokes

What do you call a poodle that serves coffee?

A Bark-ista! I said a bark-ista Coral.

What food do Japanese people serve as an apology when they have offended someone?

Miso sorry...

Pop Jokes More Pop Jokes

What's the difference between a whale and a toaster?

You didn't pop out of a toaster.

Why is K-pop the best genre of music?

It has Seoul.

Bar Jokes More Bar Jokes

How did the Ethiopian escape prison?

He squeezed through the bars.

What do a woman and a bar have in common?

Liquor in the front, poker in the back.

Bartender Jokes More Bartender Jokes

What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Weasel Jokes More Weasel Jokes

What's the difference between a stoat and a weasel?

One is weasily recognised and the other is stoatally different

What's the difference between a weasel and a stoat?

One's weasily recognised - the other's stoatally different