It's sure as hell not a bar-mitzvah, those things are expensive.
It was happy hour.
Brownian Motion
To screw in the lightbulb.
The fun guy
A-lou-AK-bar.
He overslept.
He was hammered.
A space bar.
BoozZzZzZzZzZzZ
Weight for it...
Liquor in the front, poker in the back.
Let Meowt!!!!
He was awesome at cleaning the bar, but he wouldn't stop jerking it.
So he could save his stool.
He was barred.
An elaborate fantasy in which she is in prison and tries to escape by chewing through the bars of her cell.
Klondike Bar
It's full of Boo's and Spirits.
It's when you're in the office, bed is at home and whiskey is in the bar.
Because you need to be 21 to get in.
The referee said he wanted a clean fight.
Because he wears an eyepatch and has poor depth perception.
Limbo. They don't set the bar very high.
He got him diss barred.
Liquor in the front, poker in the back ()
That's how you set the bar high.
Klondike Bars
He was making a scene!
I'd like some H20 please.
Lowering the bar. or not to.
The Piledriver: No Holes Barred
They both plat no more.
Do you ladies wanna go back to my place and conduct a double slit experiment?
He was expecting showers.
Because he was Aminor
Because the door was ajar!
A mar tiny.
Habit
Because all he says is "Chug Chug Chug"
Because they had no bars on their cells!
Because he was sheet faced.
Because the cell door was still locked.
A bar-bee!
Billiards and Billiards
Anything but Canadian Club..
Ireland: More bars in more places
You have to read ursine.
He said "Sure! I could loan some Dove".
I can't believe you just blew 50 bucks in there
A tachyon walks into a bar.
For the BOOOOze.
Because I'm about to introduce myself to the girl at the end of the bar.
They thought she might have been slipped a woofie.
He goes to a bar and slips somebody a Rupee, then gives them a Franc and some Deutsche Marks.
Because he didn't want to go clubbing.
She heard that the drinks were on the house.
A Bee-Ear
A sand bar.
Ouch...
A hog doesn't have to sit in a bar and buy drinks all night just so he can f*** some pig.
Just a couple of shots
Bonjour.*
Tekira!
I don't know.
I Expectsum Patronum
OH SNaP!
They are getting ready for the Bar exam.
She heard drinks were on the house.
A voice from the back of the bar shouts back, "You don't have enough ammo, mate!"
She was A minor.
Expecto-Patron-On-Ice
Ok you 2 dont start anything
Because the bar was rattled!
Bar tender
They're afraid of the shots.
Chardaneiiiiiiggghhhhh
He walked into a bar.
Because they were Miners...
The name's Bond, Covalent Bond
But chessy but gets a good giggle
Because he likes oldfashioned jokes.
He didn't jump high enough.
Chardon-neigh
Putting criminals behind bars seems like a bad idea once you consider all the alcohol they're now next to
They're in Greenwich Mean Time.
One must simply walk into a bar
To get drunk
ME: He's a well known, gimmick. IAN: Really ME: That's Conan. Conan The Bar Bear, Ian.
Sam-BOO!-ca
I'm bored tonight and I have a no holds barred sense of humour. What are some of your worst
A lawyer
AU, get outta here!
Ouch!
Can I please get a drink
'Where is the bar tended?'
'Can I join you?'
I'm sorry, we don't serve food here
Look out for the mice!
I'm two tiered. I came up with this at 1am, enjoy.
What would you do ew ew in a Klondike bar.
For a klondike bar
They planet
Everyone started drinking boo's. Happy Halloween!
Me: No, this is just my lunch.
Moo moos
Terrorists have sympathizers.
It blew up
Mom: typing... *gets married* *have kids* *gets old* *dies* *goes to hell* Mom: Fish, honey!
2Na
Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Opens door* Just wait until I get out there!! parenting from the bathroom