March Madness Sale - 25% Off

How do you pay a bartender?

With bar tender.

Previous Random Joke Next
Pay Jokes More Pay Jokes

Why couldn't Christopher Reeve pay his landlord?

Back rent.

What's the difference between a chickpea and a lima bean?

I've never paid to have a lima bean on my chest.

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

Bar Tender Jokes More Bar Tender Jokes

What do you use to buy drinks?

Bar tender

How do you pay a bartender?

With bar tender.