What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

Previous Random Joke Next
Think Jokes More Think Jokes

What do you think is wrong with me?

You have a broken finger!

How many movie directors does it take to change a lightbulb?

Just one but he wants to do it thirty-two times and when he's done everyone thinks that his last lightbulb was much better.

Like Jokes More Like Jokes

What does Facebook and a conversation between two teenagers have in common?

A lot of likes

What do rappers like on their burritos?

Waka Flakamole

Ask Jokes More Ask Jokes

What do you do when your suicidal friend asks for a hi-five?

You leave him hanging....

What does Aerosmith say when someone asks them for directions?

Walk this way

Canadian Jokes More Canadian Jokes

Why do Canadians call alcohol anonymous triple A?

AA, Eh

How did the bad Canadian fisherman describe his only catch of the day?

Aboot this big

Bartender Jokes More Bartender Jokes

A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Ay Jokes More Ay Jokes

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.