What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

Previous Random Joke Next

Think Jokes More Think Jokes

What do you get when you cross an oven with a car?

A hot rod. NOTE: When I was about 5, I thought this was the funniest joke on earth.

What do you call a dinosaur made of plastic bricks?

A legosaurus! Randomly made up this the other night, thought I'd share.

Like Jokes More Like Jokes

Whose mother likes rap music?

Yo Momma! My eight-year-old daughter wants to see how many upvotes she can get. Ten-year old brother is interested in downvotes.

Who here likes Olympic Frisbees?

Discus.

Ask Jokes More Ask Jokes

What did the commitment averse monster truck announcer say to his girlfriend when she asked him, "When are you going to finally ask me to marry you?

SOMEDAY ###SOMEDAY! ###SOMEDAY!!

What is the best kind of dog to ask for directions?

A Chihuahua because it knows all the shortcuts!

Canadian Jokes More Canadian Jokes

How do Canadians take care of their skin?

Maybe it's maple leaf.

What is a Canadian's favourite letter?

Eh?

Bartender Jokes More Bartender Jokes

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Ay Jokes More Ay Jokes

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.