Because when he asked his wife how many eggs to buy, she said 4!
An eggplant.
Omelette, fam
Yargg! Woman! Stop asking me! You're driving me nuts!
The quick E
For me, a year's supply.
Hubs: With the door locked. Me: She means how do we manage...but yeah.
Because baggers can't be choosers,
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
If the shutter makes a "crick" noise.
Because he got a hole in one!
Falafel and hummus.
A swallow.
The mathematician says "2" The Physicist says "2, plus or minus 0.1" The engineer says "Probably around 2, but let's say 3 to be on the safe side".
For drinking and deriving
He put in 24 carrots.
Add 24 carrots
Too Bad, I'm not telling you!
Drive me to the grocery store.
