Bar Tender Jokes

How do you pay a bartender?

With bar tender.

Couple's Daily Question Mug

$19.99

What do you use to buy drinks?

Bar tender

What did the alcoholic Dad, away on business, say to the bartender at the hotel bar?

I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either

You might also enjoy:

Business Jokes More Business Jokes

Why did the mortgage broker go out of business?

Because he lost interest.

What did the Devil say to the being that sold its soul to him?

Nice doing business with you!

Use Jokes More Use Jokes

Why don't vikings send e-mails?

They prefer to use Norse code.

What console does god use?

Praystation

Laugh Jokes More Laugh Jokes

Why should you never laugh at thieves in a car-accident?

It could be your car

Why was the man intently watching the bowl of snickers?

He wanted to see who would have the last laugh. back to work...

Pay Jokes More Pay Jokes

Why is someone who borrows money but does not pay it all back like a football player?

Because sometimes he gives you a quarter back and sometimes a half back.

What does a pirate pay for his corn?

A buccaneer!

Bar Jokes More Bar Jokes

What two games does Carl Sagan play at the bar?

Billiards and Billiards

What was the Olympic lifter missing from his bar?

Weight for it...

Bartender Jokes More Bartender Jokes

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Drink Jokes More Drink Jokes

What do you call a mathematician who drinks too much?

A functioning alcoholic.

Why do programmers drink coffee so much?

So they aren't lying when they say they like Java.

Buy Jokes More Buy Jokes

What kind of teeth can you buy with a dollar?

Buck teeth!

Where can Sihks and Muslims buy headwear?

Turban Outfitters.