March Madness Sale - 25% Off

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

Previous Random Joke Next
Drink Jokes More Drink Jokes

Why bother drinking water?

You're just gonna pee it out. This is what Big Water doesn't want you to know.

What does Batman put in his drink?

Just ice

Mean Jokes More Mean Jokes

What's in it?

HIM: What do you mean, "in it"

What other miracles can you do?

Jesus: I can varnish 'You mean vanish ' J: *running finger over a beautiful oak table* aha, not quite

Alcohol Jokes More Alcohol Jokes

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

Why do Little People hate the taste of alcohol?

Because they can't reach the top shelf.

Medication Jokes More Medication Jokes

What medications do I take?

I'm not sure. The names on my neighbor's prescription bottles are ridiculously long

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

Bartender Jokes More Bartender Jokes

What do you call a bartender giving two dolphins a drink?

Serving dual porpoises!

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Pharmacist Jokes More Pharmacist Jokes

Why can't Whitney Houston be a pharmacist?

She over doses

Why was the black man selling drugs?

He was a pharmacist.