How do you pay a bartender?

With bar tender.

Previous Random Joke Next
Pay Jokes More Pay Jokes

How much did the pirate pay for corn?

A buck an ear!

How does someone pay for a painting?

With Monet

Bartender Jokes More Bartender Jokes

What did the bartender say to the angry speaker?

We don't want any treble

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Bar Tender Jokes More Bar Tender Jokes

What do you use to buy drinks?

Bar tender

How do you pay a bartender?

With bar tender.