What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

Previous Random Joke Next
Order Jokes More Order Jokes

Why should you never order the T-bone in an Alaskan restaurant?

Because it might be a moose steak.

What did he tell people in order to make them avoid taking it?

Eschew! Eschew!

Beer Jokes More Beer Jokes

What beer does Sean Connery drink?

Grols

Where's the dog?

Flashback to me giving him the keys to the car to get more beer* ME: I let him outside.

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

Giraffe Jokes More Giraffe Jokes

Why did the mouse whisper into the elephant's ear?

The giraffe put him up to it.

Why couldn't the giraffe get a job at the bank?

They weren't hiring.

Long Neck Jokes More Long Neck Jokes

Why are giraffe's heads so far away from their bodies?

Long necks.

Why do giraffes have long necks?

Because their feet stink.