A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here

Previous Random Joke Next

Walk Jokes More Walk Jokes

Why can't the bishop walk straight?

Cause he can only move diagonally

What did Virginia get when she walked into the pet shop?

State joke) A New Hampshire

Serve Jokes More Serve Jokes

What do ghosts serve for dessert?

I Scream.

What happened when a ghost asked for a brandy at his local pub?

The landlord said "Sorry we don't serve spirits."

Bar Jokes More Bar Jokes

A SQL query walks into a bar, walks up to two tables and asks...

'Can I join you?'

Why did 20 blondes stand outside the bar?

Because you need to be 21 to get in.

Order Jokes More Order Jokes

How do you order a bill in Australian restaurant?

Cheque, mate! --- Maybe not the funniest buy posting because: My. My own. My precious...

How do you order food at a Muslim restaurant?

Allah carte.

Beer Jokes More Beer Jokes

Why did the man with an electric car think he had a dual exhaust?

He drank a lot of beer. He ate a lot of beans. *You love it.*

Why should you always take at least two Baptists fishing?

Because if you take one, he'll drink all your beer

Food Jokes More Food Jokes

Why doesn't this restaurant have any specials?

Waiter: Because nothing about this food is special.

Why do they thank me in the cafeteria when I pay for my food like I had a choice?

Just tell me "enjoy the diarrhea" and I'll move along.

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*