What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

Previous Random Joke Next
Drink Jokes More Drink Jokes

What did the Israelite say to the American when offering him a drink?

Here, try this, Israeli refreshing!

What do ants drink?

Tea. It's an ant tea joke.

Leave Jokes More Leave Jokes

What happened after an explosion at a French cheese factory?

All that was left was de brie.

What's the motto of the Greek army?

Never leave your buddy's behind.

Girl Jokes More Girl Jokes

What do you call a girl who expects a guy to do everything for her, make all the first moves, and text her first every day?

SINGLE

What do you tell a girl with two black eyes?

Nothing, you already told her twice.

Order Jokes More Order Jokes

What did the hot dog vendor say at the World Trade Center?

Who ordered the two jumbos?!

What was the last food delivered to the Twin Towers?

Pizza. Someone ordered two large planes.

Bartender Jokes More Bartender Jokes

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.