Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Asked the teacher hoping that someone would say "babies." She was disappointed when all the children cried out "Happy!"
Yes. No. Yes. No. Yes. No. Yes. No. Yes. No.
I'm sorry, we don't serve food here
A horse walks into a bar. Bartender: why the long face? Horse: because I'm a raging alcoholic.
