What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

Why are we here?

Me: Philosophers still don't know 5: No, why are we HERE Wife: Your dad is lost and won't ask for directions

What does the sterile man say when asked if he's gonna get neutered?

Vas the deferens?

Bartender Jokes More Bartender Jokes

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

What did the drunk Chinese customer say to the bartender?

No have to cut me off. Fall off barstool by myself. end metajoke