April Sale - 20% Off

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What did the couch surfing, yoga junkie say when his friend asked him to leave?

Namaste.

How do you spell elephant?

E-l-l-e-e-f-a-n-t "That's not how the dictionary spells it" "You didn't ask me how the dictionary spelt it!"

Bartender Jokes More Bartender Jokes

What did the drunk Chinese customer say to the bartender?

No have to cut me off. Fall off barstool by myself. end metajoke

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!