Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
She asked. "Except that." I replied.
Asking for a friend.
Asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.
Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*
