What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What ringtone have you got?

Murphy asked Paddy, "What ringtone have you got " Paddy said, "I've never really looked, but probably light brown

What's the worst part about locking your keys in your car, outside of a planned parenthood center?

Having to go inside and ask for a coat-hanger.

Bartender Jokes More Bartender Jokes

What did the bartender say to the angry speaker?

We don't want any treble

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender