What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

Previous Random Joke Next

Drink Jokes More Drink Jokes

How do you get a Mormon to not drink all of your beer on a fishing trip?

Bring two Mormons.

What's worse than finding a horse's head on your pillow?

Realising the horse is alive and well and how much did I drink last night!

Try Jokes More Try Jokes

Why are people who vape always trying to chase after bigger clouds?

More storage space.

What did Richard Nixon say after he tried to make dinner at the White House for the first time?

I am not a cook

Girl Jokes More Girl Jokes

What does a girl want more than anything?

Nothing. She is fine.

How do you know you are dating a women, not a girl?

A girl has no name.

Steal Jokes More Steal Jokes

Why can't you play UNO with a mexican?

They always steal the green card.

What do you get when you cross a Mexican and a black man?

Someone who steals your job then doesn't show up.

Bartender Jokes More Bartender Jokes

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.