What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

Previous Random Joke Next
Walk Jokes More Walk Jokes

What goes "oh oh oh"?

Santa walking backwards.

Why was Jon walking backwards on the first day of school?

Everyone kept saying it was back to school time.

Bar Jokes More Bar Jokes

Why don't anti-vaxxers hang out in bars?

They're afraid of the shots.

What did Bea Arthur whisper in her lover's ear?

An elaborate fantasy in which she is in prison and tries to escape by chewing through the bars of her cell.

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

How much will that be?

Asks the neutron. "For you " replies the bartender, "no charge."

Sodium Jokes More Sodium Jokes

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

Why couldn't the scientist find salt for his breakfast?

Because it was Na HA! Get it? Because Na=sodium and N/A=not available. Seriously, this is good clean fun.

Oh Jokes More Oh Jokes

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

What's that machine for?

Oh, that's the forklift" ME: OH MY GOD HOW HEAVY ARE YOUR FORKS

Hydrogen Jokes More Hydrogen Jokes

What did Ronald Reagan say in his presidential campaign?

Electron. Also, what did the Greek warrior say when he saw the wooden horse Hydrogen please spare me

Which chemical compound are you most likely to find at a frat party?

Hydrogen mide.

Sulfur Jokes More Sulfur Jokes

Why did Hydrogen hurt Iron?

Because he wanted to see him Sulfur.

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!