What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

Previous Random Joke Next
Walk Jokes More Walk Jokes

What do you call a snarky criminal walking down stairs?

A condescending con descending.

What do you call a very religious person who sleep walks?

A Roman Catholic.

Bar Jokes More Bar Jokes

Why did all the prisoners at the AT&T jail escape?

Because they had no bars on their cells!

A termite walks into a bar and says...

'Where is the bar tended?'

Bartender Jokes More Bartender Jokes

What did the brown dwarf say to the bartender?

I'd like a Corona, please.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Sodium Jokes More Sodium Jokes

Why couldn't the scientist find salt for his breakfast?

Because it was Na HA! Get it? Because Na=sodium and N/A=not available. Seriously, this is good clean fun.

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

Oh Jokes More Oh Jokes

What did King Trident say when he stepped in the whale poop?

OH CARP!!!

What do you love most in the world?

Me: You & your brother 4yo: Oh Me: What about you 4yo: The fire tree in Plants vs. Zombies Me: Oh

Hydrogen Jokes More Hydrogen Jokes

What did water say when it found out hydrogen is a diatomic?

H2 Oh!

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

Sulfur Jokes More Sulfur Jokes

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

Why did Hydrogen hurt Iron?

Because he wanted to see him Sulfur.