Bartender says, "here, but I’ll need that back in an hour!"
Ask you to extinguish your celery Doubtful.
Ask them if they play league.
I need some arrrrrrrrrrrgua!
He needed to see if how fast his grade dropped broke any laws of physics.
Because all he says is "Chug Chug Chug"
Because he didn't want to go clubbing.
The bartender replies: "For you No charge."
If you take one, he'll drink all of your beer, If you take 2 neither will drink a drop
Lock them both in the trunk of your car for an hour. Guess who is happy to see you when you open the trunk
NASCAR
AU, get outta here!
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
