What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!

Previous Random Joke Next

Gold Jokes More Gold Jokes

What would gold say if it could talk?

Au.

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!

Walk Jokes More Walk Jokes

What did the frog say when he walked into the bar?

Bonjour.*

Why did the pig walk into the kitchen?

Because he felt like bacon.

Bar Jokes More Bar Jokes

What did the man say when he walked into a bar?

Ouch!

Where did AT&ampT get their 2007 slogan?

Ireland: More bars in more places

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

Outta Jokes More Outta Jokes

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!

What did the one electron say to the other when it asked it out on a date?

Get outta here, I'm not attracted to you!