Where is all the color white?

Bartender says, "dude, this is a gray bar.

Previous Random Joke Next

Bartender Jokes More Bartender Jokes

Why the long pause?

Asks the bartender. The bear replies "Well, I am a bear"

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Dude Jokes More Dude Jokes

What did the Hippie say to the invisible elephant?

Hey dude, you're outta sight!

How is it when my son has homework,I have to be involved?

Dude,I already did my time.