What did the bartender say to the foreskin?

You're cut off.

Previous Random Joke Next

Cut Jokes More Cut Jokes

What does a Mexican cut a pizza with?

Little ceasars!!! (Scissors)

What do you say when somebody cuts in front of you in line for Vietnamese noodles?

Hey, pho queue, dude

Bartender Jokes More Bartender Jokes

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Foreskin Jokes More Foreskin Jokes

Why do cowboys have foreskin?

So they have a place to put there chewing tobacco when brushing their teeth

What did the bartender say to the foreskin?

You're cut off.