To remind them why there's no money in it
He wanted more Monet in his wallet.
The magician returns your wallet at the end of the performance
Because money talks.
Gas money
A camera that takes pictures of itself.
Bad cam'ra
You swimming pull
None
Because he catches all the snitches!
Paint him red and catch him with the red elephant trap.
AU, get outta here!
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
The third grade.
Batman can go to a store without robin.
Because their performance is lack-cluster.
Because they have BOOOOgers.
It would drink the brandy it would carry and act like a big Gorilla!
