March Madness Sale - 25% Off

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

Previous Random Joke Next
Drink Jokes More Drink Jokes

Where do terrorists go for a drink?

The Allahu Ak-Bar.

What did the Scotsman say when he went for another drink?

Hey, where'd my Glascow

Ask Jokes More Ask Jokes

What's a magazine?

Asked every guy under 30.

What would she do for $20?

Wasn't there a joke before posted about asking what a girl would do for $20 or something A dirty joke I'm trying to find it but I can't....

Reply Jokes More Reply Jokes

When I was a little boy I asked my mum 'how many is a couple?

She replied 'oh, two or three' Now I know why her marriage didn't last long

When she read the order back to me she said, "So, you have one thick sausage, anything else?

I looked her dead in the eye and replied, "Yes, I also ordered a pizza."

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

Owe Jokes More Owe Jokes

What's "68"?

You do me and I owe you one.

What do I owe ya?

Asks the neutron. "For you No charge."

Neutron Jokes More Neutron Jokes

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

How much will that be?

Asks the neutron. "For you " replies the bartender, "no charge."