What in the world is this?

The bartender says, "Central Park."

Previous Random Joke Next

World Jokes More World Jokes

What's the shortest book in the world?

Deutscher Humor!

Who is fastest girl in the world?

Airtel 4G girl.

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here