April Sale - 20% Off

When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"

Previous Random Joke Next

Know Jokes More Know Jokes

What did the man say when he got his dancing robot to work?

It twerks!" I don't know how this came to me..

How do you know when you should get a puppy?

When life's getting a little ruff...

Ask Jokes More Ask Jokes

What made the vampire a gentlemen?

They would always ask their girlfriend before they came inside.

What do you do when your suicidal friend asks for a hi-five?

You leave him hanging....

Bartender Jokes More Bartender Jokes

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Ryan Lochte Jokes More Ryan Lochte Jokes

What will Ryan Lochte say if he looses "Dancing With the Stars"?

I was robbed" Sorry, that just came to me like a stroke of idiotic genius and I couldn't help myself.

When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"