Ryan Locht-up
I was robbed" Sorry, that just came to me like a stroke of idiotic genius and I couldn't help myself.
Just say "I don't know, make something up"
GoldiLochtes
More than likely you won't see any stars.
There is lotion and used tissues laying around
Too many strokes.
Not being
Asking for a friend..
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
You're drunk ET, go home!
Because all they know is de feet
Dont worry, they'll tell you.
None. People who glow in the dark don't need lightbulbs.
Drummers
He got arrested for possession.