What did the straight edge ghost say to the bartender?

No boos for me.

Previous Random Joke Next

Boo Jokes More Boo Jokes

What did the ghost say when he got to the Halloween party?

Im here for the boos.

Why are ghosts banned from the liquor store?

They would steal all the boos.

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Who's the new guy?

And the bartender says, I don't know, but I've heard he's a shady character!