What did the bartender say to the alien?

You're drunk ET, go home!

Previous Random Joke Next

Alien Jokes More Alien Jokes

How did the alien tie his shoes?

With an astroknot.

What did the alien say when his flying saucer landed in a stud farm?

Take me to your breeder!

Bartender Jokes More Bartender Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.