What did the bartender say to the alien?

You're drunk ET, go home!

Previous Random Joke Next

Alien Jokes More Alien Jokes

How did the alien tie his shoes?

With an astroknot.

Why is it called "Alien vs Predator"?

Isn't predator an alien too They should've just called it "Some Aliens"

Bartender Jokes More Bartender Jokes

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.