What does Shaggy ask himself when he's in a bind?

What would Scooby Doo

Previous Random Joke Next

Ask Jokes More Ask Jokes

What do Mexicans cut their pizza with?

I asked, "What " He said, "Little Caesars!"

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Doo Jokes More Doo Jokes

What are the Muppet's views on the paranormal?

It's a phenomena (do doo do doodoo)

What does Shaggy ask himself when he's in a bind?

What would Scooby Doo

Bind Jokes More Bind Jokes

What did one end of the rope say to the other?

We were bound to get together...

Why does AMD call having 2 or more cards Crossfire?

Because no matter what card you cross, and how many, you're bound to start a fire.

Scooby Jokes More Scooby Jokes

Who is Scooby-Doo's evil twin?

Scooby-Don't.

What does Shaggy ask himself when he's in a bind?

What would Scooby Doo