My Ans) Black People... I dont know why do they ask such weird questions in biology.
Canadian knows the difference between a school and a shooting range.
Because when you're a carpenter in the desert you can't get wood.
A little Down.
Easy. Lock them both in a trunk and watch who will be happier to see you after you open it in 15 minutes.
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Don't worry, they've already told you the superior qualities it has over all the other smart phones by this time.
Something you keep black people in
A Buy-ologist.
Kind of a weird question for a first date, but umm I guess enough to finish the temple
