What is she doing?

The pal asks. "Waiting for me to get home."

Previous Random Joke Next

Ask Jokes More Ask Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What have you been doing" asked Jane. "Chasing a herd of elephants on vines" "Really?

Said Jane. "I thought elephants stayed on the ground!"

Wait Jokes More Wait Jokes

Why does Jesus not play video games?

Everytime he dies he has to wait 3 days to respawn

How do we know Jesus was a man?

We've had to wait 2,000 years for his second coming.

Pal Jokes More Pal Jokes

What is she doing?

The pal asks. "Waiting for me to get home."

What does an American actor say when going to Europe?

Let's go PAL.