April Sale - 20% Off

When your partner asks how many people you have ever slept with, answering 'what did I say the last time you asked?

Is unwise, apparently.

Previous Random Joke Next
People Jokes More People Jokes

How many people with ADD does it take to change a light bulb?

Lets go ride a bike!

What do people and trees have in common?

They both fall down when you hit them with an axe.

Sleep Jokes More Sleep Jokes

What do light and hard have in common?

You can sleep with a light on.

Why did the man sleep under the tractor?

Because he wanted to wake up oily.

Answer Jokes More Answer Jokes

What's the song that Coldplay wrote for you?

Yellow. *Phil answers phone*

What's the difference between a boy and a girl?

His dad answers, "Well, there's a vas deferens!"

Ask Jokes More Ask Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What is the difference between a 3D modeller and a gamer?

Ask them what a 3Ds is.

Partner Jokes More Partner Jokes

Why are people from Arkansas so good at Science?

Because they use the Theory of Relativity to find a partner.

What does Ronda Rousey's opponents and myself have in common?

We both barely last 14 seconds and leave our partners underwhelmed.