We're the Ferguson Police Department. We ask the questions.
He didn't take it - he already had a door!
I LOCK you a lot! yep, its corny, indeed, but... I'm tryin'! Skip
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Then I rip my clothes and smash stuff up!
Friend: She said you ask too many questions Me: She said that Too many questions Really Me...What else
Trick question the rooster.
Because the boxes are battered and and the speakers are fried.
In a frustrated voice) They just don't listen.
Because you gotta catch Jamal
