March Madness Sale - 25% Off

What's the best way to milk a sheep?

Ask Apple.

Previous Random Joke Next

Ask Jokes More Ask Jokes

How does a mathematician ask for money?

Give me 10! dollars

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Apple Jokes More Apple Jokes

Why do feminists hate Apple?

Because they're not PC.

What's an Apple Scottish self-aware computer called?

I, Mac.

Milk Jokes More Milk Jokes

What do a gallon of milk and the city of Carthage have in common?

Ideally you only have to sack them once, but we should probably sack them again for good measure.

Why don't cows drink milk?

Because they lactose I don't know why I found this so funny! ready for the down vote to begin 3

Good Way Jokes More Good Way Jokes

What's the best way to get a Punjab in India?

Hire a cunning linguist.

What is the best way to cut a mango?

With a knife!

Sheep Jokes More Sheep Jokes

What do you get when you cross a sheep with a robot?

Steel wool

Why should you always tend sheep near a hospital?

Because at any moment they could bleet out