Why is grandpa fine with performing tricks, but gets mad if you ask grandma?

It took him forever to get her off that street corner.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What did one atom say to the other?

I lost an electron..." The other atom asks "Are you sure " First atom replies, "I'm positive!"

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Perform Jokes More Perform Jokes

What band performed at the Jefferson memorial?

Nickelback

What do you call a fish that performs brain surgeries?

A neurosturgeon

Grandma Jokes More Grandma Jokes

Who is your Grandma's favorite politician?

Bernie Sandmaster Flash

What do you call your grandma on speed dial?

Instragram!

Grandpa Jokes More Grandpa Jokes

What weebles and wobbles but can't get up?

Grandpa having a seizure. Bonus: Statistically speaking, 1 in 5 adult men

What do you call a grandpa who couldn't understand why his email wanted to upload his attachment to share it?

An old man yelling at the cloud

Trick Jokes More Trick Jokes

Why can't you trick an aborted baby?

Because it was not born yesterday.

Why can't you trick an aborted fetus?

It wasn't born yesterday

Street Corner Jokes More Street Corner Jokes

Why is grandpa fine with performing tricks, but gets mad if you ask grandma?

It took him forever to get her off that street corner.

What do you call a potato on the street corner?

Idaho