March Madness Sale - 25% Off

Why shouldn't you ask Jon Snow what time it is?

Because his watch has ended.

Previous Random Joke Next
Time Jokes More Time Jokes

What times does Sean Connery get to Wimbledon?

Tennish

Why did the composer spend all his time in bed?

He wrote sheet music.

Ask Jokes More Ask Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What's so funny?

Asks the dermatologist. "Sorry, it's a inside joke." replies the surgeon.

Watch Jokes More Watch Jokes

What have you done wrong if the wife keep complaining when you try to watch TV in the living room?

You made the chain too long in the kitchen.

When you have the choice between cleaning the bath or doing some sport... which series do you watch?

D

End Jokes More End Jokes

Why are New Yorkers so depressed?

Because the light at the end of the tunnel is New Jersey.

Why did the marriage between the crab and the shrimp end in a divorce?

Because they were both too Shellfish.

Jon Snow Jokes More Jon Snow Jokes

Why did Jon Snow stand in line at the Apple store?

For the watch!

Why did Jon Snow wait in line at the Apple store?

For the watch.