Why do so few men end up in Heaven?

They never stop to ask directions.

Previous Random Joke Next

Man Jokes More Man Jokes

Why do women and children evacuate first in an emergency?

So the men can go on Reddit and repost this joke.

Why did the man smoke a cigarette in Beijing?

To get some fresh air

Stop Jokes More Stop Jokes

How do you stop an angry elephant from charging?

Take away it's credit cards!

What's the difference between a lorry with good brakes, and a lorry with nice brakes?

A Lorry with Nice breaks doesn't stop until after a mile.

Ask Jokes More Ask Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

How do yo get to Sesame Street?

Unzip my pants and ask big bird

End Jokes More End Jokes

What does one strawberry say to the other?

Well, if you hadn't been so fresh last night, we wouldn't have ended up in this jam!

What begins with P and ends with orn?

Popcorn, of course!

Direction Jokes More Direction Jokes

Why did the Canadian cross the road?

Because that's the direction his car was sliding.

How did you burn the Thanksgiving Turkey?

Me: I followed the directions. 20 minutes a pound at 325 degrees. I weigh 175 pounds!

Heaven Jokes More Heaven Jokes

What is Robin Williams doing in heaven?

Not sure, probably just hanging out.

Why are there no nice cars in heaven?

Because abortions float.