Atlantis Jokes

Where are the Atlantis and the lost treasures of many renowned pirates?

Nobody knows.It's a well kept seacret.

I've Got a Whole Latte Jokes

I've Got a Whole Latte Jokes

$19.99

Where is the lost city of Atlantis?

Lantis. I can't believe nobody has thought to look there yet.

Why all Pascal programmers ask to live in Atlantis?

Because it is below C level.

What is the latest fad among teenage mermaids in the city of Atlantis?

Taking shellfies with their shellphones.

You might also enjoy:

Look Jokes More Look Jokes

How many times can look at the sun with a telescope?

You can do this twice. One time with you right eye and one with your left!

How can you tell if a Redditor is an extrovert?

During any conversation he's looking at YOUR shoes.

Believe Jokes More Believe Jokes

Why shouldn't you tell a story to a solipsist?

Because they won't believe it.

Why can't atheist solve exponential problems?

Because they don't believe in higher powers.

Pascal Programmer Jokes More Pascal Programmer Jokes

Why all Pascal programmers ask to live in Atlantis?

Because it is below C level.

What does a PASCAL programmer say to a C programmer?

"Would you like fries with that "

Know Jokes More Know Jokes

Why do fluorescent lights hum?

Because they don't know the words.

Why was Snape in the middle of the road?

So you would never know what side he was on.

Shellfie Jokes More Shellfie Jokes

What kind of photos do turtles take?

Shellfies

What kind of pictures do turtles take?

Shellfies!

City Jokes More City Jokes

What US city has the dirtiest waffles?

San Diego

What is the latest fad among teenage mermaids in the city of Atlantis?

Taking shellfies with their shellphones.

C Level Jokes More C Level Jokes

Where can you find the speed of light?

At C level

Why all Pascal programmers ask to live in Atlantis?

Because it is below C level.

Ask Jokes More Ask Jokes

How can you tell between a graphic designer and recruiter?

Ask them to pronounce "hires"

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.