Xanax Jokes

Why did the Mexican take Xanax?

For Hispanic attacks.

Couple's Daily Question Mug

Couple's Daily Question Mug

Why didn't the Mexican take Xanax?

He was barred.

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender

You might also enjoy:

Cinco De Mayo Jokes More Cinco De Mayo Jokes

How did So-Cal celebrate the double anniversary of the LA Riots and Cinco de Mayo?

Rodney King Pinatas

What's honey mustards least favorite holiday?

Cinco de Mayo

Hispanic Attack Jokes More Hispanic Attack Jokes

Why did the tourist visiting Mexico bring Prolax and pepper spray?

They prevented Hispanic attacks

Why did the Mexican take Xanax?

For Hispanic attacks.

Need Jokes More Need Jokes

How many Mexicans do you need to change a Lightbulb?

Juan.

What's the difference between bird flu and swine flu?

If you have bird flu you need tweetment. If you have swine flu you need oinkment.

Mexican Jokes More Mexican Jokes

What's a Mexican's favorite sport?

Cross Country.

Why did the Mexican push his wife off the bridge?

Tequila

Feel Jokes More Feel Jokes

What did the peadophile say when he was released from prison?

I feel like a kid again

How did the firefly feel when he flew into the fan?

He was de-lighted

Bartender Jokes More Bartender Jokes

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Borderline Personality Disorder Jokes More Borderline Personality Disorder Jokes

What do you call a homeless horse with a Borderline Personality Disorder?

Unstable.

Hispanic Jokes More Hispanic Jokes

Why did the tourist visiting Mexico bring Prolax and pepper spray?

They prevented Hispanic attacks

What did the Hispanic fireman name his two twin sons?

Jose and Hose B