A labracadabrador
Nailed it
Nah brah, tadah brah!
Pesto chango
Da-Ta!!
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Who's asking
Help! I've fallen and I can't giddy up.
I was robbed" Sorry, that just came to me like a stroke of idiotic genius and I couldn't help myself.
Labracadabrador!!!
A Labracadabrador.
He hippo-tized him!
Well, the magician has a cunning array of stunts...
He developed a ten Chin deficit disorder.
Because Austria was Hungary.
30 minutes.
An English sleep dog.
Dogs have owners, cats have staff.