Magic Trick Jokes

What do you call a dog who does magic tricks?

A labracadabrador

$Your Age Is Only Math$

April Sale

Your Age Is Only Math

$5.99

What do you say when a Polish magician performs a magic trick?

Nailed it

What does a bro say when asked if he needs help doing a magic trick?

Nah brah, tadah brah!

What did the magician say when he a did a magic trick on the spaghetti?

Pesto chango

What does a dyslexic programmer say after a magic trick?

Da-Ta!!

What do you call a dog that can do magic tricks?

A labracadabrador

You might also enjoy:

Ask Jokes More Ask Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

How many wiseguys does it take to change a lightbulb?

Who's asking

Help Jokes More Help Jokes

What did the horse say when he fell over?

Help! I've fallen and I can't giddy up.

What will Ryan Lochte say if he looses "Dancing With the Stars"?

I was robbed" Sorry, that just came to me like a stroke of idiotic genius and I couldn't help myself.

Labracadabrador Jokes More Labracadabrador Jokes

What do you call a magical dog?

Labracadabrador!!!

What do you call a dog that is also a magician?

A Labracadabrador.

Magician Jokes More Magician Jokes

What did the hippopotamus do to the magician?

He hippo-tized him!

What's the difference between a line of naked women and a magician?

Well, the magician has a cunning array of stunts...

Disappear Jokes More Disappear Jokes

What happened to Mr. Chin after all 10 of his children disappeared?

He developed a ten Chin deficit disorder.

Why did Turkey disappear?

Because Austria was Hungary.

Perform Jokes More Perform Jokes

What do performing bears at the circus get for lunch?

30 minutes.

What do you say when a Polish magician performs a magic trick?

Nailed it

Osama Bin Laden Jokes More Osama Bin Laden Jokes

Dog Jokes More Dog Jokes

What dog is always tired in London?

An English sleep dog.

Whats the difference between cats and dogs?

Dogs have owners, cats have staff.