Au Jokes

What did the gold say when it saw the puppy?

Au.

Couple's Daily Question Mug

Couple's Daily Question Mug

What did the miner say when he struck gold?

Au, yeah!

What did Silver say to Gold?

Au!

What did the goldsmith say when he stubbed his toe?

Au

What did the gold miner say when he met the singer of Pink Floyd?

Au

You might also enjoy:

Find Jokes More Find Jokes

What do you call soup that you've found a hair in?

Rabbit Soup

What do you say when you find two banana peels together?

A pair of slipper

Turn Jokes More Turn Jokes

Which playing card can turn its hand to everything?

Jack of all Spades

What did the A/C unit say when it suddenly turned on?

Sorry, I just needed to vent

Spaniard Jokes More Spaniard Jokes

How do Spaniards take their coffee?

Au lait.

What did the German say when the Spaniard asked him for some cheese?

Mi Kase es su Kase.

Pour Jokes More Pour Jokes

What's the difference between a vampire with toothache and a rainstorm?

One roars with pain and the other pours with rain.

What do you get when you pour boiling hot water down a rabbit hole at Easter?

Hot Cross Bunnies!

Bartender Jokes More Bartender Jokes

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Nanny Jokes More Nanny Jokes

What do you call a docks nanny?

An Au'Peir

What did the kid say to his nanny when she stubbed her toe while trying to catch him?

Nana boo boo

Color Jokes More Color Jokes

What do you call a chihuahua with a rainbow colored fur?

Chihuehue

What color does your skin turn when you pour molten gold onto it?

Au-burn

Want Jokes More Want Jokes

Why did the poor art collector only buy miniature paintings?

He wanted more Monet in his wallet.

Why did the old man buy his wig at the thrift store?

Because he didn't want toupee.