He used the Cross Walk.
He tried to skip the Cross walk.
Because she kept throwing out all the W's
Because she threw out all the bent ones.
The joke is it's own pun-ishment.
For the pun of it.
Spot
They'll freak out when they hear a helicopter
It was stuck to the chicken.
It didn't like being double crossed.
When you help an old lemon across the street.
Aladdin the street wants a word with you!
Leave the plunger in the toilet
ME: *leans in way too close* Leaving it.
Ell if I know.
Tusk Tusk I am so sorry
I was at an event the other day and someone asked "So... anyone know any jokes?" What's everyone's "go to" joke in social situations?
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.