Rudolph Jokes

Why did the kids not receive presents for Christmas?

Because Rudolph intentionally grounded the team...

Interactive Joke of the Day Mug

5.0

Coffee Mug

What did Pinocchio say to Rudolph when he asked him what he asked for Christmas?

Quit being nosey.

What was Rudolph's nickname?

Names. Because they used to laugh and call him Names. Credit to my dad.

What did the reindeer wear to protect itself while Santa was watering the garden?

Rudolph's red hose rain gear...

Why did Kim Jong-il die a week before December 25th?

Because Rudolph is the only deer leader at Christmas.

You might also enjoy:

Ask Jokes More Ask Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What a BLONDE will ask the doctor in the maternity ward?

"Is it mine "

Wear Jokes More Wear Jokes

What do you call a woman who's not wearing underwear?

A barracuchi.

Why don't chickens wear underwear?

Because their peckers are on their faces.

Protect Jokes More Protect Jokes

What's big and grey and protects you from the rain?

An umbrellaphant!

Why does Steve Irwin hate sunblock?

It doesn't protect from harmful rays

Pinocchio Jokes More Pinocchio Jokes

What do Justin Bieber and Pinocchio have in common?

Both want to be real boys

How did Pinocchio realize he was made of wood?

His hand caught on fire.

Credit Jokes More Credit Jokes

What's Hillary's favorite pizza place?

Little Seizures Edit: credit to Joe Biggs rambobiggs

What did one eye say to the other eye?

Between you and me, something smells. Credit: Christmas cracker.

Quit Jokes More Quit Jokes

What did the momma hawk say to her chicks?

Quit falcon around or get the flock outta here!

Why did the programmer quit his job?

Because he didn't get arrays.

Water Jokes More Water Jokes

How do you convince your neighbor to share their water with you?

Try to get a long well.

Where is the water main?

So I turned on the tap & said, "Right here, main."

Team Jokes More Team Jokes

How many maple leafs does it take to change a tire?

Only 1, unless it's a blowout then the whole team shows up

What do you call a team of Christian mutant superheroes?

The A-Men