Burger Jokes

What do you call a burger made from 50% beef and 50% veal?

Half Calf

Couple's Daily Question Mug

$19.99

How does the enthusiastic chef serve his burgers?

With relish

What did PSY say when he choked on a burger?

Whop, Whop Whop Whop Whop... Whopper Gangnam Style.

What do you call a cow if he enjoys burgers?

A cannibull

What's the difference between a white girl who likes to tan and a burger?

They both need to be flipped every 10 mins, but only one turns pink when its done.

Why did the burger sit beside the telephone?

Incase onion rings

Where do Communists go to get burgers?

Czechers.

Why aren't burgers the least bit scared of Halloween?

They're used to people 'goblin' them!

How does a burger acquire good taste?

With a little seasoning!

What did they do to the burger who thought he was a rooster?

Cook-a-doodle-do!

How far do burgers go in school?

Through cowlege (then they get their 450 degrees!).

I've Got a Whole Latte Jokes

$19.99

Where does a burger go on vacation?

The Swiss (cheese) Alps or The Cheeseapeake Valley!

What can you say about Ham Burger and Chief Justice Warren Burger?

Ham Burger is 'well done' and Chief Justice Warren Burger has 'done well'!

What do some people have against cheeseburgers?

They say 'Burgers can't be cheesy!'

What kind of baseball do burgers play?

Ketchup baseball!

How do fast food restaurants make so much money?

OC "They flip burgers for profit!" Just thought of this at a baseball game today, kinda quirky and simple!

What's the difference between a burger and a burglar?

Cooking times.

Why aren't burgers too good at basketball?

Too many turnovers!

Why do burgers laugh when you surround them with pickles?

Who knows - maybe they're picklish!

What did they tell the burger who enlisted in the Army?

You've got no beef soldier!

Where did the burgers go after their wedding?

On a bun-eymoon!

Everyday Deserves a Joke

$19.99

Which people do the burgers hate?

The ones who are always putting the bite on them!

Which burgers are dishonest?

Cat-burgers! (burglars)

Which dances do the burgers do best?

The burger-loo and the char char!

Where do you go to get a burger on the internet?

McDownloads!

Where do burgers go when they die?

Burgatory

How 'done' do you want your burger?

I can do "well-done" all the way to "CPR might actually work."

What do you call a guy that steals burgers?

A hamburglar!

Why are so many people obese these days?

Because burgers are$.99 and salads are $4.99

Which burger is famous for a long nose?

Cyrano de Burgerac!

What do you call a burger that merged with a laptop?

A big mac*

Which burgers can tell your fortune?

Medium burgers!

How do we know burgers love young people?

They're pro-teen!

What do burgers think when they are surrounded by gherkins?

They think they are in a pickle.

Where does a burger feel at home?

On the range!

You might also enjoy:

Wrap Jokes More Wrap Jokes

What is Santa's favorite music?

Wrap! (I came up with this when i was 8.)

Why did the mummy stop using the Internet?

He was getting far too wrapped up in it.

Complaint Jokes More Complaint Jokes

Heart Attack Jokes More Heart Attack Jokes

What happens when an American has a heart attack and survives?

A 'murical.

What is the worst time to have a heart attack?

During a game of charades

Remove Jokes More Remove Jokes

What is the best place for politicians?

Election posters. There they are portable, silent and easy to remove.

How do you turn a seal into a sea lion?

Remove an electron.

Applicant Jokes More Applicant Jokes

How many applicants does it take to change a light bulb?

Only one but 200 applied for the job.

What are some of your weaknesses?

Applicant: I'm lazy I: that's it A: I'm lazy to list them all...

Interviewer Jokes More Interviewer Jokes

What if earth rotates 30 times faster?

Interviewer:"If the Earth rotates 30 times faster, what will happen?" engineer:"We will get our salary everyday" :D Think Greedily Act Confidently

What's your strength?

Candidate: I fall in love easily. Interviewer: What's your weakness? Candidate: Those blue eyes of yours.

American Jokes More American Jokes

What do you call an American communist?

Manifesto Destiny

Which political discussions between the Russians and Americans keenly interest Burger Land citizens?

The SALT talks!

Ask Jokes More Ask Jokes

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What is it called when you ride around on a horse asking people questions?

A gallop poll.