Because he drank his coffee before it was cool.
Depresso.
Because it keeps Peein' n peein'
Hebrews it.
Tsarbucks
Cause it doesn't want to be latte. Sorry. I just came up with this lame joke. Downvotes ahoy!
The French Press Secretary!
When asked for his name by the coffee shop clerk, my brother-in-law answered, Marc, with a C. Minutes later, he was handed his coffee with his name written on the side: Cark.
Grounds for termination.
Double double doubles
Because it's not called a purconow.
Because proper tea is theft.
Katie Keurig. (I know the setup might need some work but I just like the punchline I made up.)
Starbucks
Because she used #nofilter
He buys it from Starbucks...
Private employee starts work checking email. Public official starts works making a coffee.
Decalfinated.
The one who can bring his friends two cups of coffee and a dozen donuts.
A Bark-ista! I said a bark-ista Coral.
Add $5 to a cup of coffee.
Au lait.
They want to finish before it's cool.
Because they were being "brewed"
Ground Coffee.
Neither. It's a Thai.
The guy who can carry a cup of coffee in each hand and a dozen donuts.
Pilatte
Getting ready for work
In a nest-cafe!
Who are these iron-mouthed warriors
100% abracadabra
When he has sufficient grounds
A Mugging.
So they aren't lying when they say they like Java.
He was mugged.
DUN-DUN-DUUUNNNNkin Donuts.
Because that would be "grounds" for termination!
Tarbucks.
I feel positively charged!
Uh..Orally. Why How do you take it Freak.
Me: It'll make u even more energetic than u already are 7: But u drink it all the time& u never have energy!
A farte
With Starbucks!
Decapitated
The one who can carry two cups of coffee AND a dozen donurs!
Tsarbucks.
Me 5: Me: Get some coffee
One. She just holds it up there and waits for the world to revolve around her.
When you see your mother-in-law backing off a cliff in your brand new car.
Stand up!
N! One to change the light bulb, and n-1 to display stereotypical behavioral traits of X!
He brews!
Cause beer is made with hops.
There's no place like cd
Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Answer "Scissors." then drive away..
It was stumped.
I answer back... You mean in bed
5-year-old: A baby. Woman: What kind of baby 5-year-old: A human one. Nailed it.
PIKA PIKA PIKA (Credit to my 5 year old son)