Cat Jokes

What do the French call artificial feet for cats?

Faux Paws

Couple's Daily Question Mug

$19.99

What is worse than raining cats and dogs?

Raining elephants!

What's a cats favorite Mexican dish?

A purr-rito

Which dog looks like a cat?

A police dog in disguise.

Why did the cat put the letter "M" into the fridge?

Because it turns "ice" into "mice"!

What did Dr. Seuss call the book he wrote about Star Wars?

The Cat in the AT-AT

What was Schrodinger's favorite childhood book?

The Cat in the Box by Dr. Seuss

What do you cal a man with no arms and no legs fighting with his cat?

Claude

Where do cats write down notes?

Scratch Paper!

Why couldn't the cat speak?

The dog taped his mouth.

Why did the cat sleep under the car?

Because she wanted to wake up oily!

I've Got a Whole Latte Jokes

$19.99

What does a twelve-pound mouse say to a cat?

Here Kitty kitty kitty'!

Why did the cat join the Red Cross?

Because she wanted to be a first-aid kit!

What do you call it when a cat stops?

A paws!

Why do cats like to hear other cats make noise?

It's meow-sic to their ears!

Why happened when the cat swallowed a coin?

There was some money in the kitty!

What do you call a cat wearing shoes?

Puss in boots!

Who abhors a vacuum more than nature?

A cat.

What do you get if you cross a cat with a bottle of vinegar?

A sourpuss!

What kind of cat should you take into the desert?

A first aid kitty!

What has more lives than a cat?

A frog -- it croaks every night.

Everyday Deserves a Joke

$19.99

Whats so special about "demon cats"?

Aren't all cats pure evil

Where do cats go when they die?

Purrgutory.

What do you call a man without arms or legs who gets into a fight with his cat?

Claude!

What does a cat say when he likes something?

It's purrrfect.

What do you get if you cross a cat with a dark horse?

Kitty Perry

What kind of cats lay around the house?

Car-pets!

What does a cat call a bowl of mice?

A purrfect meal!

Why is a cat like a penny?

Because it has a head on one side and a tail on the other.

Why do you need a licence for a dog and not for a cat?

Cats can't drive!

What does a cat say when it lands on it's back?

Me. Ow.

How can a cat walk with no feet?

He can't, it's impawsible.

What's long and stylish and full of cats?

The Easter Purrade!

What did the woman do when a lemon tree fell her cat?

Nothing, she just stood there with a sour puss

What's the unluckiest kind of cat to have?

A catastrophe!

Why do cats chase birds?

For a lark!

What's the difference between a frog and a cat?

A cat has nine lives, but a frog croaks every night.

What do you call a cat on a big plate?

A platterpuss

What did the cat do when he didn't want to watch the movie?

He paws-ed it!

When the cat's away.....?

The house smells better!

Which game did the cat want to play with the mouse?

Catch.

What did the cat... Say to the person?

Nothing, because cats don't speak.

How many lost cats walk by the telephone pole with their missing flier on it?

Just another reason to teach your cat to read.

What's it like to tweet "My cat sneezed" and get 500 RT in the first minute?

My cat would be dead before I got 50

What type of wind is named after both a cat and a bat?

Katabatic

What's a good name for a cat?

Catsper.

What do you call a storm that's raining cats and dogs?

A furrycanine

Which cat won the race?

The English cat. Un deux trois cat sank.

Why did the cat give birth at the park?

Because the sign at the park said "Fine for Littering"

What do you call a cat when he first wakes up with the alarm clock?

Catsup!

What noise does a cat make going down the highway?

Miaooooooooooooooooooooooooooooooooow!

What did the cat use to sharpen its claws?

Me. Ow.

What country do all cats wish to get their food from?

Viet NOM NOM NOM NOM NOM

What noise does a cat make when it drives past really fast?

Meeeeeeeoooooowwwww

Which is Better, a Cat or a Dog House?

A dog house, because a cat house has no woof!

What did the cat say when he lost all his money?

I'm paw!

What does a cat say when its trapped in a box?

Let MEEEOOOOOOOOWWWWWWt

What do you call a cat who uses fake finger prints?

An im-paw-ster.

What do you call a cat that torrents movies?

A copy cat.

Why did the cat go to the hospital?

To have a CAT scan done.

Where do you find a birthday present for a cat?

In a cat-alogue!

Why are cats longer in the evening than they are in the morning?

Because they're let out in the evening and taken in in the morning!

When should a mouse carry an umbrella?

When it's raining cats and dogs!

How to cats greet each other at Christmas?

A furry Merry Christmas & Happy mew year"!

What happened when the cat ate a ball of wool?

She had mittens!

Why is a cat on a beach like Christmas?

Because they both have "Sandy claws"!

What does a cat sleep on?

A caterpillow.

Why does everyone love cats?

They're purr-fect!

Why dogs are called K9?

Because cats are K10

What do you call it when a cat howls?

It Meyowls

What do cats read in the morning?

Mewspapers!

Why do cats make better medical technicians than dogs?

Because dogs can't operate MRI machines, but catscan.

What do you call a group of unorganized cats?

A CAT-ASTROPHE!

Where did the cat go when it lost it's tail?

To the retail store!

Why is a frog luckier than a cat?

Because a frog croaks all the time but a cat only gets to croak nine times!

How do you know if you cat's got a bad cold?

He has cat-arrh!

What's Anakin Skywalker's favorite animal?

Well, it was cats, originally, but then he was turned to the dog side.

What's a cat's favorite firearm?

A meowser

What do you call a pile of cats?

A Meowtain.

You might also enjoy:

Understand Jokes More Understand Jokes

Why are sea sponges good at statistics?

They understand coralations!

What did phenolphthalein do when he couldn't understand his Chemistry homework?

He just added Acetic Acid until it became clear.

Cat Bark Jokes More Cat Bark Jokes

Win Jokes More Win Jokes

What do you call an alligator that wins a race?

A chompion. (7-year old me thought he was very clever.)

How did the barber win the race?

He knew a short cut.

Gasoline Jokes More Gasoline Jokes

What does gasoline taste like?

I don't know, I'm in a coma.

What country most despises cars that run on gasoline?

Mad-at-gas-cars!

Rum Jokes More Rum Jokes

Why do differentiating mathematicians prefer Manhattans to Mojitos?

Ryes over rum.

Push Jokes More Push Jokes

How many South Dakotans does it take to go ice fishing?

Four. One to cut the hole in the ice and three to push the boat through.

Why do Lannisters have such big beds?

GoT because they push twins together to make a king.

Bartender Jokes More Bartender Jokes

What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Difference Jokes More Difference Jokes

What's the difference between a princess and a witch?

2 years of marriage.

What's the difference between a bag of cocaine &amp a small child?

Eric Clapton would never let a bag of cocaine fall out of a window...