Ask Jokes

The surgeon asked the patient that was about to be anesthetized. "But doc this is my first operation." "Really It's mine too and I am not excited at all."

Why don't you ask about the home life of a filing cabinet?

It's usually a sorted affair.

What do you call an awkward questioner?

I don't KNOW, that's why I **asked** you. God.

When asked "why?

He replied, "Tropical Depression."

What did the pirate say when asked how old he was?

Aye Matey!

What's the hardest part about working as a nurse or doctor at a women's hospital?

When you ask the patients "what's the problem " They'll say "nothing"

What's wrong with these eggs I ordered?

Waiter: Don't ask me. I only laid the table.

How does a witch doctor ask a girl to dance?

Voodoo like to dance with me '

When you go to a regular movie, a friend asks you "so how good was the movie?

When you go to an M.night Shamylan movie a friend asks " So how bad was the plot twist "

What did one Melon say to the other after it was asked marry it?

We Can't Alope

How do you make a motherboard?

I asked him. He said, "Tell her about my job."

What haircut did the Texan barber recommend when asked?

He couldn't think of anything, and said "I'll mullet over"

What's the worst question you can ask a blind date?

So.. you seeing anyone

What did the bunny ask his boss for?

A raise in *celery*.

Who currently provides your Internet?

He asked. I said, "My next door neighbour."

Where the hell did you get?

The barkeep asks. "I won it, playing cards", says the pig.

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What did the impatient waiter ask the gluttonous aardvark?

Is that your final ant sir!

Why do they ask you if you want paper or plastic at the supermarket?

Because baggers can't be choosers.

What ringtone have you got?

Murphy asked Paddy, "What ringtone have you got " Paddy said, "I've never really looked, but probably light brown

What about the kids?

He asked. I said, "they're still together."

What did the girl sea say when the boy sea asked her for a date?

Shore.

Who would you ask for advice about a lion?

A lion or a gerbil The lion, because by virtue of being a lion, a lion is an expert on lions.

What did little Paul Bunyan say when his mom asked him how he damaged his favorite toy?

It was an ax-I-dent.

What did the throwing star say when I asked her if she could hit her target?

Of course, I'm shuriken.

What would you guys like to ask an American?

Nevermind they'll just tell you anyway

What does Shaggy ask himself when he's in a bind?

What would Scooby Doo

How many plug-in air fresheners does it take to mask the decay of human flesh?

I'm asking for for a friend.

What's the first thing the pope did after resigning?

Asked Jerry Sandusky for his lil black book.

What did the grocery store owner say to the customer that asked him if he sold tires?

He shrugged and said, "I've got asparagus."

Why would you ask me for directions?

You just saw me walk into a closed door.

What did one bodybuilder ask the other?

How much do you whey bro

When faced with a challenging situation I calmly ask myself "what would The Hulk do?

Then I rip my clothes and smash stuff up!

What products do you use for grooming?

She asked me. Her face looked quite taken aback when I said, "Facebook"

Whatever's the matter?

Asked her mother. 'I don't know' replied Mary 'but the teacher thinks I may have caught decimals.'

What do you ask a Mexican girl you like?

Netflix and chili

What did Gandhi say to the British, after they asked him to move?

Nah, mastay

What should you do if a bird poos on your car?

Don't ask her out again

What are we waiting for?

The doctor asks. "Patients, Doctor," replied the nurse. "Patients."

Why is this wet?

She asks. "Because it's below C level."

You might also enjoy:

Crotch Jokes More Crotch Jokes