Ask Jokes

What did Adele say when asked where her dog is?

Groomer has it

Everyday Deserves a Joke

$19.99

What do you get if you ask a bear to spare some of his salmon?

The Bear Glare.

Why Colonel had a bunch of underwears?

Because, Brigadier General asked him to debrief his team.

How do people know spiders are more afraid of me than I am of them?

Like, did you ask him Because only one of us is screaming right now.

What did the ocean ask the scooba diver?

Water you doing here

What asks no question but demands an answer?

A doorbell or a ringing telephone.

How do you make a Game of Thrones fan sad?

You ask them to hold the door for you.

What does an accountant say when you ask him the time?

It's 9.18 am and 12 seconds no wait - 13 seconds no wait - 14 seconds no wait......

What did the car dealer ask the oscilloscope?

Sin or cosine

How do you tell the difference between a factory worker, and a chemist?

Ask them to pronounce 'unionized'

What is wrong with me?

Asking for a friend..

I've Got a Whole Latte Jokes

$19.99

When I was on the plane the stewardess asked, do you need some headphones?

I said, Hell Yeah, but how did you know my name was Phones

What's the difference between a married guy and a single guy?

Wait, let me ask and make sure it's ok to tell the joke.

Why do baseball pitchers make bad doctors?

Because when asked to 'give it to them straight', they throw a curveball!

What does the scientist say when asked if Invisibility Cloak will be applicated by the military?

Yes, but you won't see it any time soon.

When do accountants laugh out loud?

When somebody asks for a raise

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

Why don't you ask about the home life of a filing cabinet?

It's usually a sorted affair.

What do you call an awkward questioner?

I don't KNOW, that's why I **asked** you. God.

What did the pirate say when asked how old he was?

Aye Matey!

What's wrong with these eggs I ordered?

Waiter: Don't ask me. I only laid the table.

Couple's Daily Question Mug

$19.99

How does a witch doctor ask a girl to dance?

Voodoo like to dance with me '

What did one Melon say to the other after it was asked marry it?

We Can't Alope

How do you make a motherboard?

I asked him. He said, "Tell her about my job."

What haircut did the Texan barber recommend when asked?

He couldn't think of anything, and said "I'll mullet over"

What did the bunny ask his boss for?

A raise in *celery*.

Who currently provides your Internet?

He asked. I said, "My next door neighbour."

What will it be?

Asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What did the impatient waiter ask the gluttonous aardvark?

Is that your final ant sir!

Why do they ask you if you want paper or plastic at the supermarket?

Because baggers can't be choosers.

What did the girl sea say when the boy sea asked her for a date?

Shore.

What did little Paul Bunyan say when his mom asked him how he damaged his favorite toy?

It was an ax-I-dent.

What did the throwing star say when I asked her if she could hit her target?

Of course, I'm shuriken.

What would you guys like to ask an American?

Nevermind they'll just tell you anyway

What does Shaggy ask himself when he's in a bind?

What would Scooby Doo

What did the grocery store owner say to the customer that asked him if he sold tires?

He shrugged and said, "I've got asparagus."

What did one bodybuilder ask the other?

How much do you whey bro

When faced with a challenging situation I calmly ask myself "what would The Hulk do?"

Then I rip my clothes and smash stuff up!

What products do you use for grooming?

She asked me. Her face looked quite taken aback when I said, "Facebook"

What did Gandhi say to the British, after they asked him to move?

Nah, mastay

What should you do if a bird poos on your car?

Don't ask her out again

What did the judge ask when he went to the dentist?

Do you swear to pull the tooth, the whole tooth and nothing but the tooth

Why do I need the life vest?

Me: If you have to ask, you might not need one.

Why does my computer always ask me if I'm "sure" about stuff?

Yes, I want to delete my hard drive.

What did Pitbull ask for Christmas?

Dolly.

What's your favorite kind of music?

Asked one windmill to another. The windmill responds, "I'm a metal fan."

How can you tell a chemist from a plumber?

Ask them to pronounce "unionized".

Why would my wife ask if I was wearing this shirt when it's already on?

Stop talking in secret code.

What do you do if you lose all the information on your computer?

Ask the NSA for a backup.

When ur at chipotle n u ask for guac and they say "its extra is that ok?

If u say its not ok they give it to u for free

Why aren't you doing very well in history?

Because the teacher keeps asking about things that happened before I was born!

How many women have you slept with wife asked husband, "How many women have you slept with?

He proudly replied, "Only you, Darling. With all the others I was awake."

What's the worst thing about being a Jehovah's witness?

Nobody asks, 'who's there ' when you try and tell a knock knock joke.

How do you tell the difference between a scientist and a plumber?

Ask them to pronounce unionized.

How can you tell a gamer from a rugby player?

Ask them if they play league.

What did the Canadian say when asked what he thought about stereotypes?

Eh.

A man asks a trainer in the gym: "I want to impress that beautiful girl, which machine can I use?"

Trainer replies: "Use the ATM"

When one points and asks his friend, "Is that statue a foot?

To which his friend replies, "No, it's about four and a half feet."

How many Chinese workers does it take to make a Smartphone?

I dunno. Ask the kids.

What did the Redditor say when... What did Redditor say when asked why he failed his PSAT test?

TL;DR

Whats worse than Bad command or File name?

Windows update message asking you to restart your computer

Why did the college student ask for a refund on his student loan?

Because his *degree* didn't work!

Whenever a waiter asks, "Do you want to hear about our specials?

Push the menu aside and softly whisper, "I want to hear about you."

How do you spell wrong?

R o n g. That's wrong. That's what you asked for isn't it

What did the pig do when a beetle landed in his feed trough?

He ate it quickly before the others could ask him to share.

When she asks "is that your puppy?

Say "No. That's my dad." Then storm off.

What did the wall ask the picture?

All together now!) ***"How's it hangin' "*** Skip

How many 1st AD's does it take to screw in a light bulb?

Why are you asking me that question Can't you see I'm busy!

What did the llama say when asked to a picnic?

Alpaca lunch!

What is Blair Walsh's favorite song?

I have no idea honestly, you would have to ask him

What does a blonde say when you asked her what the last two words of the national anthem are?

Play ball.

How many women have you slept with My wife asked me, "How many women have you slept with?

I proudly replied, "Only you, Darling. With all the others I was awake."

How do you spell ichael?

The teacher was rather bewildered. "Don't you mean Michael " she asked. "No ma'am. I've written the 'M' already."

Why did Yoda never get married?

Because when he was standing by alter, and asked "If he would take this women as his lawful wedded wife " His response was "Do I "

What did the Mexican princess ask her sister?

Tijuana build a snowman

Who did the philosophy major ask out for the Halloween dance?

Nobody. He was too 'Freud.

What's the difference between a preschool and a terrorist training camp?

Don't ask me...I just fly the drones!

How many reps would you usually do?

He asked. "A million," I rep lied.

When people go to ask me "hey man, are you from Los Angeles?

I'll be like "nah dude,I just really like the French feminine definite article"

What did the vulture say when the airline agent asked if he wanted to check his luggage?

No, thanks, it's just carrion...

Who, you ask, turns the AC on during a polar vortex?

Sociopaths, fascist dictators, my boyfriend.

When I have complicated problems I always ask myself, what would my imaginary wife do?

And then I end up buying myself cupcakes, and shoes.

What does a blonde say when you ask her if her blinker is working?

Yes. No. Yes. No. Yes. No. Yes. No. Yes. No.

Why do you think I spend too much time at my computer?

Well dear... Every time I ask you to close the windows you answer with "Please wait while your computer shuts down"...

What did Sherlock ask his friend when he wanted to know what they were having for dinner?

Watson the menu

What did Julius Caesar ask when finding a color to paint the Senate?

Ecru, Brute

What does COINCIDENCE' mean?

Student Funny, I was just going to ask you that.

What did the German say when the Spaniard asked him for some cheese?

Mi Kase es su Kase.

When the cashier asks me "Is that everything?

I feel like crap inside because obviously my order didn't satisfy her.

Why didn't the skeleton ask out the Zombie to go to the Halloween party?

He didn't have the guts

What makes you think you can criticise American gun laws, sitting over there in the UK?

I was asked on an internet forum. "Because you're not allowed to take them on planes," I answered.

What's the difference between toilet paper and a knife?

Oh, you don't know I won't ask you to wipe my bum then.

Why shouldn't you ask Jon Snow what time it is?

Because his watch has ended.

When my laptop asks "Are you sure?

It's because it still remembers all of the other bad decisions I have made.

What's the first thing an Owl asks when you trow a rock at it?

HOOO did that!

When a coworker tells everyone he proposed, I'm the guy that asks, "So, what did she say?

I'm funny that way.

What do you ask from Santa Claus this year?

Oh, just 50 dollars, like always.

What is Samsung PR team's Christmas jingle you ask?

The phone we gave you is frightful, But the fire is so delightful; And since we have no replace to go, Let it blow! Let it blow! Let it blow!

How do I know he was French, do you ask?

He went oui, oui.

What does a guy want more than anything in the world?

It doesn't matter. He has to ask his wife first.

You might also enjoy:

Moose Jokes More Moose Jokes